Unique by Design

Unique by Design

... has a boastful title and the gleam of gold, but is actually made of paper cord
and canvas. Bakker's Diamond brooch of 1991 juggles illusion and substance by
setting a real diamond against a laminated photo of a sparkling round-cut stone.

Author: Suzanne Ramljak

Publisher: Yale University Press

ISBN: 9780300208764

Category: Antiques & Collectibles

Page: 135

View: 681

A notable collection of 20th-century studio jewelry in various media and styles is the subject of this dazzling catalogue, which reframes these works within the context of contemporary art.
Categories: Antiques & Collectibles

Homemade for Sale

Homemade for Sale

But this is not glitz with no substance underneath. ... “In today's world with big
commercial, industrial operations, folks like seeing exactly where their cake will
be made and know who is making it. ... “Each cake I design is a unique creation.

Author: Lisa Kivirist

Publisher: New Society Publishers

ISBN: 9781550925821

Category: Business & Economics

Page: 240

View: 210

The authoritative guide for launching a successful home-based food enterprise, from idea and recipe to final product. From farm-to-fork and "Buy Local" to slow food and hand-made artisan breads, more people than ever are demanding real food made with real ingredients by real people. Widely known as "cottage food legislation," over forty-two states and many Canadian provinces have enacted recent legislation that encourages home cooks to create and sell a variety of "non-hazardous" food items, often defined as those that are high-acid, like pickles, or low moisture, like breads or cookies. Finally, "homemade" and "fresh from the oven" on the package can mean exactly what it says. Homemade for Sale is the first authoritative guide to conceiving and launching your own home-based food start-up. Packed with profiles of successful cottage food entrepreneurs, this comprehensive and accessible resource covers everything you need to get cooking for your customers, creating items that by their very nature are specialized and unique. Topics covered include: Product development and testing Marketing and developing your niche Structuring your business and planning for the future Managing liability, risk, and government regulations You can join a growing movement of entrepreneurs starting small food businesses from their home. No capital needed, just good recipes, enthusiasm, and commitment, plus enough know-how to turn fresh ingredients into sought-after treats for your local community. Everything required is probably already in your home kitchen. Best of all, you can start tomorrow! Lisa Kivirist and John D. Ivanko are co-authors of Farmstead Chef , ECOpreneuring , and Rural Renaissance , and are innkeepers of the award-winning Inn Serendipity Bed & Breakfast (innserendipity.com).
Categories: Business & Economics

Mindfulness Related Treatments and Addiction Recovery

Mindfulness Related Treatments and Addiction Recovery

Although other acceptance- and mindfulness-based treatments or protocols with
related components have been applied to substance abuse samples, MBRP is
uniquely designed to address the specific needs of this population. The current ...

Author: Marianne Marcus

Publisher: Routledge

ISBN: 9781135757038

Category: Social Science

Page: 136

View: 233

While mindfulness meditation has been used in clinical settings as an adjunctive treatment for substance use disorders for some time, there has been limited empirical evidence to support this practice. Mindfulness-Related Treatments and Addiction Recovery bridges this gap by reporting the findings of studies in which mindfulness practice has been combined with other behavioural treatments and/or adapted to meet the needs of a variety of client populations in recovery. Therapies used as interventions in the described studies include Mindfulness-Based Stress Reduction (MBSR), Mindfulness-Based Cognitive Therapy (MBCT), Dialectical Behavior Therapy (DBT), Acceptance and Commitment Therapy (ACT), Mindfulness-Based Relapse Prevention (MBRP), and Mindfulness-Based Therapeutic Community (MBTC) treatment. The book offers a glimpse into the many ways in which mindfulness strategies have been applied to various facets of the recovery process including stress, craving, anxiety, and other relapse related factors. Preliminary evidence, while not conclusive, suggests that mindfulness-based therapies are effective, safe, satisfying to clients, and that an individual, at-home mindfulness practice can be potentially sustained over time, beyond the intervention duration. This book was originally published as a special issue of Substance Abuse.
Categories: Social Science

Cognitive Therapy of Substance Abuse

Cognitive Therapy of Substance Abuse

Other techniques (e.g., identification of high-risk stimuli) are uniquely designed to
assist patients in the relapse prevention process. Prior to presenting these
techniques, the cognitive model of drug use and relapse is reviewed. This model
 ...

Author: Aaron T. Beck

Publisher: Guilford Press

ISBN: 9781462504329

Category: Psychology

Page: 354

View: 294

Cognitive therapy offers a well-documented and cost-effective psychosocial treatment model for working with substance abuse disorders. Comprehensive and accessible, this volume clearly details the cognitive model of addiction, the specifics of case formulation, management of the therapeutic relationship, and the structure of the therapy sessions. It discusses how to educate patients in the treatment model and procedures and manage their cravings and urges for drugs and alcohol. Specific cognitive and behavioral strategies and techniques are described in detail, as are methods for understanding and working with patients who present concomitant problems of depression, anxiety, low frustration tolerance, anger, and personality disorders. Also addressed are such significant issues as crisis management and relapse prevention. Enhancing the utility of the volume are appendices featuring sample client inventories and checklists. These forms are designed to help the clinician identify targets for intervention, track progress over time, and develop an individualized relapse prevention plan for each client.
Categories: Psychology

Substance Abuse Treatment and the Stages of Change

Substance Abuse Treatment and the Stages of Change

treatment is uniquely suited to viewing change as a multidimensional, personal
process that includes the stages of change. ... and moves from decision making
to creating and committing to an action plan depends both on individual effort
and a variety of unique circumstances. ... Individual treatment is designed to
assist each addicted individual to move forward in the process of change, to
consolidate ...

Author: Gerard J. Connors

Publisher: Guilford Press

ISBN: 9781462508044

Category: Psychology

Page: 356

View: 262

A widely adopted practitioner resource and course text, this book shows how to apply knowledge about behavior change in general -- and the stages-of-change model in particular -- to make substance abuse treatment more effective. The authors are leaders in the field who describe ways to tailor interventions for clients with varying levels of motivation or readiness to change. They draw on cutting-edge theory and research to explain what works (and what doesn't work) at different stages of change. Rich clinical examples illustrate the "whats," "whys," and "how-tos" of using the stages-of-change model to inform treatment planning and intervention for individuals, groups, couples, and families. New to This Edition *Reflects the ongoing development of the stages-of-change model and research advances over the past decade. *Chapter on stage-based brief interventions in health care, social service, and community settings. *Group treatment chapter has been significantly revised. *Expanded coverage of the change processes relevant to each stage.
Categories: Psychology

Substance Abuse Treatment and the Stages of Change Second Edition

Substance Abuse Treatment and the Stages of Change  Second Edition

treatment is uniquely suited to viewing change as a multidimensional, personal
process that includes the stages of change. ... and moves from decision making
to creating and committing to an action plan depends both on individual effort
and a variety of unique circumstances. ... Individual treatment is designed to
assist each addicted individual to move forward in the process of change, to
consolidate ...

Author: Gerard J. Connors

Publisher: Guilford Press

ISBN: 9781462508068

Category: Psychology

Page: 356

View: 721

A widely adopted practitioner resource and course text, this book shows how to apply knowledge about behavior change in general -- and the stages-of-change model in particular -- to make substance abuse treatment more effective. The authors are leaders in the field who describe ways to tailor interventions for clients with varying levels of motivation or readiness to change. They draw on cutting-edge theory and research on the transtheoretical model to explain what works (and what doesn't work) at different stages of change. Rich clinical examples illustrate the "whats," "whys," and "how-tos" of using the stages-of-change model to inform treatment planning and intervention for individuals, groups, couples, and families. New to This Edition *Reflects the ongoing development of the stages-of-change model and research advances over the past decade. *Chapter on stage-based brief interventions in health care, social service, and community settings. *Group treatment chapter has been significantly revised. *Expanded coverage of the change processes relevant to each stage. See also Group Treatment for Substance Abuse, Second Edition, by Mary Marden Velasquez et al., a manual for a group-based approach grounded in the transtheoretical model.
Categories: Psychology

Bioconjugate Techniques

Bioconjugate Techniques

... activities can be chemically combined to create unique substances possessing
carefully engineered characteristics. ... for creating novel conjugates with peculiar
activities has made possible the assay of minute quantities of substances, the ...

Author: Greg T. Hermanson

Publisher: Academic Press

ISBN: 0080568726

Category: Science

Page: 1323

View: 605

Bioconjugate Techniques, 2nd Edition, is the essential guide to the modification and cross linking of biomolecules for use in research, diagnostics, and therapeutics. It provides highly detailed information on the chemistry, reagent systems, and practical applications for creating labeled or conjugate molecules. It also describes dozens of reactions with details on hundreds of commercially available reagents and the use of these reagents for modifying or cross linking peptides and proteins, sugars and polysaccharides, nucleic acids and oligonucleotides, lipids, and synthetic polymers. A one-stop source for proven methods and protocols for synthesizing bioconjugates in the lab Step-by-step presentation makes the book an ideal source for researchers who are less familiar with the synthesis of bioconjugates More than 600 figures that visually describe the complex reactions associated with the synthesis of bioconjugates Includes entirely new chapters on the latest areas in the field of bioconjugation as follows: Microparticles and nanoparticles Silane coupling agents Dendrimers and dendrons Chemoselective ligation Quantum dots Lanthanide chelates Cyanine dyes Discrete PEG compounds Buckyballs,fullerenes, and carbon nanotubes Mass tags and isotope tags Bioconjugation in the study of protein interactions
Categories: Science

The Bathroom Companion

The Bathroom Companion

Dead red blood cells create the brownish color . Several diseases can alter the
color of stool . Thank the following compounds , among others , for creating the
substance's unique and well - known smell : indole , skatole , mercaptans ...

Author: James Buckley

Publisher: Quirk Books

ISBN: 1594740283

Category: House & Home

Page: 144

View: 407

Everyone reads in the bathroom. Now Quirk has produced the ultimate bathroom book about bathrooms.Complete with trivia about toiletries, fixtures and plumbing, The Bathroom Companion is chock-full of bizarre water-closet information. Were the first toothbrushes made from corn cobs or hog bristles? Was the flush toilet invented by John Harrington or Thomas Crapper? Before toilet paper did French royalty use lace or socks? The answers to these and even stranger questions lie within, along with dozens of illustrations and handy diagrams. Tastefully packaged, this collection will look elegant sitting on the toilet tank and will appeal to anyone who enjoys Schott's Miscellany or Uncle John's Bathroom Readers.
Categories: House & Home

Bringing Home the Message

Bringing Home the Message

From this description, we glean that the man has a unique and purposeful
relationship to the earth. The earth formed the substance from which he was
made, and its cultivation was the context into which he was placed. By contrast,
the woman ...

Author: Robert K. Perkins

Publisher: Wipf and Stock Publishers

ISBN: 9781630874216

Category: Religion

Page: 202

View: 239

Believing that study and application of Scripture in the context of Christian community can greatly enhance the transformative power of the preached message, in Bringing Home the Message Robert Perkins aims to help pastors integrate small group ministry with their preaching. Perkins lays out the biblical, theological, historical, and sociological basis for the importance of hearing God's Word in the context of community, and provides a practical methodology for implementing sermon-based small group Bible studies. This helpful book also includes a sample fourteen-part series of Study Guides and Leader's Notes for the Gospel of Luke. Step-by-step instructions illustrate how to prepare effective inductive Bible study questions for small groups that will challenge members to grow in their faith and discipleship through understanding and applying God's Word together.
Categories: Religion

The New Spinoza

The New Spinoza

THEORY attributes vis - a - vis substance : the attributes are in substance , as
aspects or moments through which it is constituted . ... circumvent by emptying of
all content the propositions that do not yet concern the unique and really existing
substance , in order to turn ... For then creating a substance is the same as
creating its attributes.13 But God , a substance that includes all the attributes , "
creates ...

Author: Warren Montag

Publisher: U of Minnesota Press

ISBN: 0816625409

Category: Philosophy

Page: 259

View: 665

Modeled on THE NEW NIETZSCHE, this collection revitalizes the thought of Spinoza. These essays establish Spinoza's rightful role in the development and direction of contemporary continental philosophy. The volume should interest not only the growing group of scholars attracted to Spinoza's ideas on ethics, politics, and subjectivity, but also theorists in a variety of fields.
Categories: Philosophy

Lichen Dyes

Lichen Dyes

... the decomposition of certain lichen substances ( depsides , depsidones )
orsallia North American AM dye made from a ... other substances ) unique to
lichens ; dye precursors ; historical and modern applications include cosmetics
and dyes ...

Author: Karen Diadick Casselman

Publisher: Courier Corporation

ISBN: 0486412318

Category: Crafts & Hobbies

Page: 82

View: 494

Noted textile designer and lichen expert explains how to create and use dyes derived from lichens. Text covers history of the use of lichen pigments, safe dyeing methods, ecologically sound dyeing, and use of mordants, lichen identification, and more. Text also offers a fascinating history of Asian and European lichen pigments, Scottish, Irish, and Scandinavian domestic lichen dyes, and others.
Categories: Crafts & Hobbies

The Changing Landscape of a Utopia

The Changing Landscape of a Utopia

In the paper he claims that it is possible to create garden spaces with diverse
esthetic features by using appropriate ... These garden spaces with their unique
design attributes turn the garden from a collection ofplants into an artistic creation
with esthetic experiences for the visitor. ... it and fill it with substance [and to give
the observer] clear and complete pictures from several points ... ifthe garden is
too ...

Author: Shmuel Burmil

Publisher: Wernersche

ISBN: 9783884622841

Category: Collective settlements

Page: 344

View: 142

Categories: Collective settlements

Adolescent Substance Use Disorders An Issue of Child and Adolescent Psychiatric Clinics of North America E Book

Adolescent Substance Use Disorders  An Issue of Child and Adolescent Psychiatric Clinics of North America   E Book

The level of empirical support of the interventions was evaluated using
established guidelines. ... MDFT is uniquely suited to address adolescent
substance abuse and related disorders given its comprehensive interventions
that systematically target ... 577 Yifrah Kaminer and Mark Godley This article
addresses less developed areas of clinical research that are of great importance
for better understanding ...

Author: Yifrah Kaminer

Publisher: Elsevier Health Sciences

ISBN: 9781455700202

Category: Medical

Page: 225

View: 534

This comprehensive issue on Substance Abuse in youth begins with articles on epidemiological trends, genetic risk factors, neurobiology of substance use disorders, and race and gender associations, and then provides detailed reviews on prevention and various treatment methodologies. Treatments discussed include individual and group interventions (motivational interviewing and cognitive behavioral therapy), contingency reinforcement, multidimentional family therapy, pharmacotherapy, and post-treatment aftercare. Also reviewed in detail are substance use disorders and psychiatric comorbidity. The issue then takes a close look at two emerging areas of concern in youth: gambling and internet occupation, and energy drink use. By all accounts, a must-read issue for psychiatrists everywhere.
Categories: Medical

Medical Terminology Made Incredibly Easy

Medical Terminology Made Incredibly Easy

Usually , this mechanism moves a substance from an area of lower concentration
to an area of higher concentration . ... it all together Tissues are groups of similar
cells that perform the same role ; each tissue has at least one unique function .

Author:

Publisher: Lippincott Williams & Wilkins

ISBN: 0781788455

Category: Medical

Page: 410

View: 460

Written in the award-winning, lighthearted Incredibly Easy! style, this book is an excellent aid to understanding and retention of medical terminology. The first chapter focuses on key concepts of medical terminology, including common word components. Subsequent chapters cover individual body systems, providing in-depth definitions that connect words to their meanings. This Third Edition features new chapters on obstetric and mental health terms and expanded "Pump Up Your Pronunciation" charts. Two eight-page full-color inserts offer a closer look at anatomical terminology. A companion Website offers student and instructor ancillaries including a pronunciation guide with hundreds of terms, "Pump Up Your Pronunciation" study cards, practice exercises, PowerPoint presentations, and a test generator. Online Tutoring powered by Smarthinking--Online tutoring, powered by Smarthinking, gives students access to expert nursing and allied health science educators whose mission, like yours, is to achieve success. Students can access live tutoring support, critiques of written work, and other valuable tools.
Categories: Medical

Creation

Creation

up and overlap, locking into continuous threads that have built-in give. Because
of this ... Its physical properties make spider silk an extremely desirable
substance for humankind. It is tougher ... Although Freckles the spider-goat is a
striking example of our prowess with gene mixing, she is not at all unique. This is
genetic ...

Author: Adam Rutherford

Publisher: Penguin UK

ISBN: 9780141970226

Category: Science

Page: 272

View: 376

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Categories: Science

High Pressure Shock Compression of Solids V

High Pressure Shock Compression of Solids V

... synthetic diamond , possesses a series of unique properties so new important
applications can certainly be developed . ... mass speed produced by explosive
detonation , new substances or substances with unique features can produced .

Author: Lee Davison

Publisher: Springer Science & Business Media

ISBN: 0387954945

Category: Science

Page: 248

View: 560

This volume is concerned primarily with the chemical and physical effects of shock waves on typical materials. It compares naturally occurring materials with similar materials produced by shock compression in the laboratory, providing clues about the environment and events that produced the natural materials.
Categories: Science

How Glass is Made

How Glass is Made

These metallic oxides in combination with other ingredients create color .
Opaque glass is made by adding fluorides which crystallize , some upon cooling
and some upon reheating . Glass therefore is a unique substance , clear or
colored ...

Author: Toledo Museum of Art

Publisher:

ISBN: UOM:39015041732895

Category: Glass

Page: 22

View: 753

Categories: Glass

Heresy

Heresy

“This is nonsense! Out of what could the son possibly have been created, if not
out of the Father's substance? ... presents the greater difficulty, for the unique and
ingenerate substance of the Father, by its nature, cannot be shared. If it could, the
 ...

Author: Frank Spinella

Publisher: Wipf and Stock Publishers

ISBN: 9781630872359

Category: Fiction

Page: 172

View: 197

It is early in the fourth century AD, and Christianity has become a religion in search of a theology. Roman persecution has ended, but doctrinal debates threaten to tear the church apart as the early church fathers strive to solve a mystery inherited from their apostolic tradition: how both Father and Son might be thought of as God, and yet as distinct, without doing violence to the tenet that God is One. Enter Arius, a Libyan priest who comes to Alexandria to preach an answer: that the Son of God is a created being of a different substance than the Father, and not fully divine. When the Archbishop condemns his teachings and banishes him from the city, Arius' local apostacy expands into a worldwide schism as bishops and clergy throughout the Mediterranean world take sides. Desperate to use the religion as a force for political unity, the Christian emperor Constantine calls a convention of bishops at Nicaea to resolve the dispute. As debate begins, a consensus answer seems out of reach--until a young Alexandrian deacon presses a solution that will forever shape orthodoxy in a different direction.
Categories: Fiction

Clean Air Act Amendments of 1990

Clean Air Act Amendments of 1990

6 UNIQUE SUBSTANCES • Health - based standards established for unique
chemical substances of listed pollutants without CAS numbers must be made
with regard to the health and environmental effects of the substances actually
emitted ...

Author:

Publisher:

ISBN: UOM:39015041090096

Category: Air

Page:

View: 248

Categories: Air

Treatment of Adolescents With Substance Use Disorders

Treatment of Adolescents With Substance Use Disorders

Sometimes, legal, social, or health circumstances in a young person's life create
unique problems that require attention. ... By the time these adolescents enter the
juvenile justice system, they have developed serious substance use disorders ...

Author: Ken C. Winters, Ph.d.

Publisher: DIANE Publishing

ISBN: 9780788185854

Category: Social Science

Page: 126

View: 932

Adolescents differ from adults both physiologically & emotionally as they make the transition from child to adult &, thus, require treatment adapted to their needs. This report details the scope & complexity of the problem. Presents factors to be considered when making treatment decisions. Discusses successful program components. Describes the treatment approaches used in 12-Step-based programs, therapeutic communities, & family therapy respectively. Discusses adolescents with distinctive treatment needs, such as those involved with the juvenile justice system. Explains legal issues concerning confidentiality laws.
Categories: Social Science